Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1653
Contig Information
Length 918 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10b02    rwhms10b02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_006236 [Oryza sativa (japonica cultivar-group)]
Score 646
Evalue 1.56756e-65
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1653
AACCTTGACTTGATTAGGAAAGAAGCAGACAAATTGGGCCTGACTTCAAGAGCTGATGGTCTCAGGAATCCTATCCTGGAAGTTATTCTAGAGGAGCTAA
CTTACAACACAATCTACTTATTCCCATTTCTTTTGGCCTTCACCGAGTGGAAGTGGAAATTGCAGATTATCCTGCAGTACTTCTCAAGATATCAAGTTAA
GTCTGCAGTCCGTACTCGGAGGTCAGATAACTCTCAACAAGATTTGACAGTGGAAAGCGCTCTGAGTATGTTTTCAACAGACGCAAGCGCAAAGGCCATG
GTTAAGATGATGTGTCCAGAAGTTGCTCAGCTTCTCTTAGCACATGCATACCAGGTCTGCCTATCCGTTGATGGTGATTCTAGCGAAGCTAATGATGCAG
CAAAAATGATGGGAGCGTCTCTTCTCGAGATATCTTGCAAGTTTGTGTCCGCTTTCCAAAATTTGAGAAAAATCAACGCGAACATTCAGATTTCGCAGTT
TGAGAAAGAAGCTTTGTTCACTGCAGCAACGCTGGCAAGAAAACTGCAGAACAAGTAAAGATTGGAGACTTGGAAGTATTCATTTTGGATTTTGGAGGCT
TGGAAGTGATGGGATCAAATGGTTTATCTTAAGAGAACGATAGTATCTTTGTCTCATCTATTATATGCTACCTGTGTACATATATTTCGGTTATCTATTT
CCTCTGTAGAAGAGTATCCGACGCTGACGTAGAGAACTGAAGCATCTGGGTTGCTCATCTCGGGGCAGATATCAAATTCACTTAGTTTTCTGCTTGGCAA
ATATGTACTAGAGAATGCTGGTTTCGTCTTAGATGGTAACCAAGCAAACCAGCCCGGGTGTACTAGAAGAGGCTGAAATCTAGGGCCTTGTTGTTAGCCC
TGAGAGCAAGGCTAATCT
page-top