Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1572
Contig Information
Length 1009 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10a09    rwhms10a09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit beta1 proteasome-1D [Aegilops tauschii]
Score 159
Evalue 5.39137e-09
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1572
CATGCCCCAGCCGCCATAGTGGAGCCCTACGCCGCCGCCGAGATCGGAGAGGAGCCGCCGCTGCCGAGGTTCGAGAGGAGCTGGCCACCACGACCTCCCT
CCCCAGGCGGCCGCCACCACCCCCTCCCCAAGCAGCCATGTACAGCAGGGCGGCGCCCACGCGCCTGGCCTATGTAGGTCTCGGCCTCCCTCCTCCCTTC
GTCCAAGGCCAGGAGCTCCCCCTCCCCGACCCGATCTGGTGGAGAGAGGGCCAGGCCTTGCCACTCCGGTGGTCGCTATGGCCAGATCTGTCCGGGGTAG
TCGCCGTAGAGCCTCTATGGCGGCGGAGTAGCAGCAGCCCGACAGAAGGTGGGTGCCAGATCGTCGTCCAGCAGCTCGCCGTCGGAGCTTCTCACTACAG
GCGATGGAGGTAGGGATGATGCTGCGGATGGGATGGGAAGATGTGTGTGTGTGCTAGCTGCTTCACATACGACTCAGAGAAAGAATTGCTTTGCAGTTTC
AGGTTGCCAACATCACGAATTTCATACTTATGGAGTGGAGCCACCAAACAATTTATGAGATTTCCGCCATGGACGCCGCCTCGCTCATGGGCTCCTCCTC
CACCGACGCACGCACCGACGGGGAGCACCGGATGGGCATCACCATCATGGGCGTCTGCTACGACGGCGGCGTCCTCGCCGCTGACACTCAGGACCAGCAC
CGAGAGGTTCCACGACTTCGGTTTGGCTATCATCAAAATTGGAGGAGAGCCCGATGCATTGGAGAGCATCATCCGCGAGTTCCACAGGATCGAATTGAGC
GAAGTAGCATTTCTGGTAAAATGGATAGATAGGGGTCTCTAACAGATGTTACCATATGTTATTGAATCTCAAGATAGGCAAGTATCTCTGACAGATGTTA
GCATATATTCTTGCATCTCGAGATGATATTGGATAGCTTGCGTGTGCATATTTCTCAAGGATAATTGATTTATGTGATATGGCTGCAGTCATGCTTGCAT
TAGCATCAA
page-top