Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1568
Contig Information
Length 796 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhms17f06    rwhms19o15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 941
Evalue 7.53663e-100
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1568
GTCTCATAACATCCAGGTTTCACCAAAGCTTACATTAGGACAGTATGTAAGGCACAAGACAGACACCACCAAGGGCACGATATGCAGCGCTAACAGCTGA
ACAGCTAAAATATACCCAGTACGAACAATGCCCTTAACAAAACTCAGCCAATACTAAAAACTGCTTGGTGTCTGAAACAGTGATTTGGATATCAATTGTG
GAATTACTTCTTCTTGATGGCAGCCTTGGTCACCTTGGCCCCGGTTGGGTCCTTCTTCTCAACGCCCTTGATGACACCAACAGCCACAGTCTGCCTCATG
TCACGGACAGCAAAACGACCAAGAGGAGGGTAAGTGGCAAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACTATGCCAGCATCACCATTCT
TGAGGAACTTGGGCAGGGCCTCCAGCTCCTTACCAGACCGCCTGTCGATCTTGGTCACCAGCTCAGCAAACTTGACAGCAATGTGTGAGGTGTGGCAGTC
CAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCTGCCTCCTTGGCAGGGTCATCCTTGGAG
TTGGATGCAACAAACCCACGCTTCAGATCCTTCACGGCAACGTTCTTGACGTTGAAGCCAACGTTGTCACCAGGAAGCGCCTCCAGGAGAGACTCATGGT
GCATCTCAACGGACTTGACCTCAGTTGTCAGACCAGTGGGACCAAAGGTAACAACCATACCAGGCTTGATGACACCAGTCTCAACACGGGCCAACA
page-top