Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1524
Contig Information
Length 769 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhms17i23    rwhms19a06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0404300 [Oryza sativa (japonica cultivar-group)] >gi|50878444|gb|AAT85218.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579053|dbj|BAF17416.1| Os05g0404300 [Oryza sativa (japonica cultivar-group)] >gi|215765925|dbj|BAG98153.1| unnamed protein product [Oryza sativa Japonica Group] (no hit)
Score 272
Evalue 1.23561e-22
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1524
GTAGCATAACTGTTCAATTGCGACTTAATGAATGATTTTCCAGATTAGTAGGTACATCTGACTTAATAAATGATTTTCCAGATTAGTAGGTACATCTGAC
TTAATAAATGATTTTCCAGATTACTAGGTACTTCTGACGATCCTGCCGGTGGAAATTCACGGTCACAGATTTGTCCAGAATCAAATAGCTCTTCACGTCT
CTTCAGCCATCGAAGCTCCAACGAGAGAAACATCCATTCGACGGTGCAGCGATAATTGTACTGTAAGCTTCATTTGGGTAATACACGGACCACTTACAGC
TGTTCAAGCTACATAAATTATTTCTAACATAAGACATCTTACATTATGAAGCAGCTGACCACAAGAAATAGGGTCTAAAATGTTCTTACAGGATAATATG
ATCCTTCCATACAGAGAAATACTTAAATTTAGTTCAGAATATCATACAAATAAACACAATTTTGAGTGAAGAACATATGTGCAAGATTTGGTTATGCTGG
ACTGCATGTAGTTGTCGAGTACAGATTTGTGATGATGTTGTACAATTTCTCTATATCAATGCAAGTAACTTCTGAATGAATTCAAGATAATTTTTGAATG
AAATAGGTACTTTGTCAAAGCTTATGTACGGTTCAGCGGTATGTAAATTATCAATTGTACCTTTGGTCTTTCGAGGGTAGCTCCATGAACGATTTGCGAC
GGTAGAACGTTGTGCCATGTAGTCGGATCGGACGAGGGGTGCGGACAAAGGAGCACACCAGCACACAGG
page-top