Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1499
Contig Information
Length 514 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10e24    rwhms10e24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0891000 [Oryza sativa (japonica cultivar-group)] >gi|57899789|dbj|BAD87534.1| putative beta-N-acetylhexosaminidase [Oryza sativa Japonica Group] >gi|113534583|dbj|BAF06966.1| Os01g0891000 [Oryza sativa (japonica cultivar-group)]
Score 553
Evalue 2.65843e-55
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1499
GTCAGCAACCAGGATAAGTGGTACCTAGATCACCTGGATGCTACATGGGAAGGATTCTATATGAATGAACCATTGACAAATATCTACAACCCAGAGCAAC
AGAAGTTGATTCTTGGCGGAGAAGTATGCATGTGGGGAGAACACATAGATGCATCTGACATTCAACAAACCATTTGGCCTCGTGCTGCAGCAGCTGCAGA
GCGGCTATGGACTCCCGTTGAGAAGCTCGCGAAGGACACAACGGCGGTCACTGCAAGATTGGCACACTTCAGGTGCTTGCTGAATGAGAGAGGGGTCGCT
GCAGCGCCGCTGGCTGGATATGGCCGCACAGCTCCGTCGGAACCAGGATCCTGTGTAAGGCAGTAGGACATTCATAATGGGGGTAAATACCATTCATACA
GGAATAAACATCAGTCCGAGGCATCCTTTTTTTCACCGTTCTGGGCAATGAAGCCCGGACAAATGTACTGATTCAGGATGTTCTGTGATGCAAGGGGATG
TTTCAAAAAAAAAA
page-top