Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1489
Contig Information
Length 1057 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10e21    rwhms10e21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0177300 [Oryza sativa (japonica cultivar-group)] >gi|34393841|dbj|BAC83445.1| putative z-protein [Oryza sativa Japonica Group] >gi|50509166|dbj|BAD30317.1| putative z-protein [Oryza sativa Japonica Group] >gi|113610562|dbj|BAF20940.1| Os07g0177300 [Oryza sativa (japonica cultivar-group)] >gi|125557424|gb|EAZ02960.1| hypothetical protein OsI_25100 [Oryza sativa Indica Group] >gi|125599310|gb|EAZ38886.1| hypothetical protein OsJ_022369 [Oryza sativa (japonica cultivar-group)]
Score 848
Evalue 7.32394e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1489
CGCCGTCGCCGGGCGTGATGAAGGGCGGCGACGTCGAGGCGGGCACCGCGGAACCGAAGGGGACGACGGAGAGCCCCGAGCTGCGCTGGGCGCTCATCCG
GAAGATCTACGTCGTCCTCTGCCTGCAGCTTCTCCTCACCGCCGCCGTCGCGGTCGTCTTCGTCAGGGTCCGCGCCATACCCCACTTCTTCGTCTCCTCC
TACGCCGGCCTCGGGCTCTACATCTTCATCCTCATCTTCCCCTTCATCGTGACGTTCCCGTTGCACTTCTACCGCCAGAAGCACCCAGTCAACCTGCTTC
TGCTTGGCGTCTTCACAGTGGCCATCAGCTTCTCTGTCGGCTTGACATGTGCCTTCACTAGCGGCAAGGTCATTTTGGAGGCTGGGATTCTTACAATCGT
AGTTGTCTTGAGCCTCACTGCTTACACCTTCTGGGCTGCAAGGAGGGGCAAGGACTTTAGCTTCCTTGGTCCTTTCCTATTTGCTTCTCTGATGATTTTG
CTCGTCTTTGGGTTCATTCAGATCTTCTTCCCGCTGGGCAAGCTCTCTCATATGATCTATGGCGCGCTGGCGGCACTCATCTTCAGTGGCTACATTGTCT
ATGACACGGGCAGCATCATCAAGCGTTACAAGTATGACAAGTATGTCTGGGCTGCCGTCACGCTCTACCTTGACATCATCAATCTGTTCCTGGGCCTGCT
GACTCTGTTTAGGGCGTGTGACAACTAGGCACGTCTTCCTGCCCCTGCTCTCTCGTGCTTCAAATCCCGTCGACGAATTTGGTATCCTGATGAGTCCTTG
ACATGAAGAATTGTATAGTCTGGTCTGTCTTGCTGGCACGGTGAAAATGTTGCTTACTTTAGTTCAGTTGATTGATCCCTAGTATAGAGGAAACATAAGA
AAACCGTGCGTCGGTTCTATTCTATGGATGGTAGATGTGATGTTGTATTTAGGGGGTCTTTGACATGCTGGATTGGTGGTGCTGCGTTTCTGATATCATT
TGTGTAGCCGTGTGGCTTCTGGACGAGGGCTTTCTGGTCTGTCTAGTGGGTGGCGTT
page-top