Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1424
Contig Information
Length 541 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10f10    rwhms10f10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit low-molecular-weight cysteine-rich protein LCR70 precursor [Zea mays] >gi|195659187|gb|ACG49061.1| low-molecular-weight cysteine-rich protein LCR70 precursor [Zea mays]
Score 121
Evalue 3.85068e-05
Total Hit Count 100
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1424
GAGCACTTGGCCATGGCGTTCAACGGCGCCCAGATGCTCGCTGCCTTCACCCTGGGCATTCTCCTCATGGCCTTCTGTGCGGAGGCTCGGGTATGCATGT
CCCCTAGCAAGTGGTACAAAGGGGACCCTTGCAAGAACCTGCGTTGCACCAAGGCTTGTCACAAAGAACACTTCAAGGGTGGGTTTTGCTCCAGTAAAAA
GTCGATCGTTGATGACGAGCTCAATGAAGACAATGGCAACAACAGCTTTGGCAAACGGCCTAAGAAAAAATCGAAAAAATCGTGCATGTGTACATTCCCA
TGCGGTCAAACCCCACCACCACCGTCGGAACCTGATGTGCCAGAGCCGCCCGAAGTGCCAGTGCCCGGGCCACCGCCGAGGGCCGGCCATATTTATTGAG
TGAGTAAATGATCGTATGTATGAACCTGAGGTCTCGAGGAAAGAGAGGAAACAATCACTGCTTAATTTGTACACATGCATGATTGATTGCATAAGAATGA
CAATAATAATAATCTAAAGTGAATCAACAGTAAAAAAAAAA
page-top