Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1404
Contig Information
Length 724 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10f14    rwhms10f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_009494 [Oryza sativa (japonica cultivar-group)]
Score 639
Evalue 6.59081e-65
Total Hit Count 198
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1404
ACACACAGCCCATCCCCGCAGGGCCGAGATCCCCGCCCCACTCCTCCGGACAACCGCCGCCGACTCGCCGGCCCTCACCGCCTTCCCGGCCGCCGGCGCT
CCCGCTGTAGTACGTTGCAGGACTTCGTGTGCTCTTCTTCACCAGTGCCGTCTAAGATGGTGTCCTTTGAGATGAATGACCTTAAGAAGATAGGGCTAGG
CCTGACAGGCTTTGGAGTATTCTTCTCCTTCCTGGGAATCGTTTTCTTCTTTGACAAGGGGCTTATTGCTATGGGCAATATACTCTTCCTGTCAGGTTTG
GGTTTGACAATTGGTCTGAAATCAACTATGCAGTTCTTCACAAAGCCTAAGAATTACAAGGGTACCATCTCATTTGGCGCAGGCTTTTTCCTGGTTCTCA
TTGGATGGCCTTTCTTTGGCATGCTCTTAGAGGCATATGGTTTTATCGTACTCTTCAGTGGGTTCTGGCCAACTCTCGCAGTTTTCCTGCAAAGGATTCC
TATCCTTGGCTGGATTTTTCAACAACCATTTGTCACTTCGTTCCTTGACCGTTACAGAGGGAAACGAGTGCCGGTGTAGTATCATTTCGTGCTATGTTTC
TTATGTAGCAGCTGAAGTTTTTTTCCTTCCCTGGGGATAACAGCAAGTAGTTGTGCCATCCTGGTCTTTCCCTTTACCTGTTTACTTACTGGTGACTGTC
CTTTGTAAATTACACCCCCGGATG
page-top