Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig977
Contig Information
Length 823 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10c10    whms19g19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|19273|emb|CAA32618.1| unnamed protein product [Solanum lycopersicum] >gi|295810|emb|CAA37212.1| elongation factor 1-alpha [Solanum lycopersicum]
Score 1291
Evalue 2.06948e-140
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig977
GTCTTTGACTCATCGCCTCCTCCCTCCCCCTCCCTCCTCGTCGCCGGCCAGCCAGGTAGTTCGTAGCTCCAGCAGCCATGGGCAAGGAGAAGATCCACAT
CAGCATTGTGGTCATTGGCCATGTCGACTCTGGCAAGTCAACCACGACTGGCCACCTCATCTACAAGCTTGGAGGCATTGACAAGCGTGTGATCGAGAGG
TTCGAGAAGGAAGCCGCTGAGATGAACAAGAGGTCTTTCAAGTACGCCTGGGTGCTTGACAAGCTCAAGGCTGAGCGTGAGAGAGGTATCACCATTGATA
TTGCTCTGTGGAAGTTCGAGACCACCAAGTACTCGTGCACTGTCATTGATGCTCCTGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCA
GGCTGATTGTGCTGTGCTTATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTTGCTTTC
ACTCTTGGTGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGATGCCACCACTCCCAAGTACTCGAAGGCCCGTTACGATGAAATTGTCAAGGAAGTCT
CTTCATACCTGAAGAAGGTCGGTTACAACCCTGACAAGGTTCCCTTTGTCCCCATCTCTGGGTTTGAGGGTGACAACATGATCGAGAGGTCCTCCAACCT
TGACTGGTACAAGGGCCCAACCCTGCTTGAGGCGCTTGACCAGATCAATGAGCCCAAGAGGCCCTCCGACAAGCCCCTGCGTCTTCCCCTTCAGGACGTG
TACAAGATTGGCGGCATTGGAAC
page-top