Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig26
Contig Information
Length 874 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl54j05    rwhfl54j05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18877 [Oryza sativa Indica Group]
Score 141
Evalue 5.13946e-07
Total Hit Count 64
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig26
atccaatccccaaaccagcgcaagcgacaagcctcgaaacccaagatctacgtcgacagcagaggaaccatcaatcaatcaagaagaggccatggcgggc
aaggaggaggcggggaagttgatggtcagtccgggcagcgctgccaattcggcggaggccggcgtcgatggtcctgcggcggtgttctcctccgccgccg
gattcatctaCAAGGAGGGTGACGAGTCAGAGAAGGGGTTTGCTGCGATTGAGAAGATGCTTGGGGAGGCGAATCTGTCATCCAATCAGCCAGCCGCAGC
ACCACCAGgtcccaAACAAGGGCAAGGTTCGGCTGTCGAAAGCCGAGATTAGGAGCATAATTGCCCTGAAGCCGGAGCAACAACCCAGCGCGGATTACCT
GGACGATCTGGCAGAGTATTTCCCTCCGGAGTGGATTGAGGAAAGGAAGCGTGCCCACGCCGACAGCGTAAAGCTTTTCAAGAAGATGGACGATGATTTC
GAAGAGTACAGGCAGCAGGTCATCGCGTCTGTGCGGGAcaagggctacttcgaggtcgatgaagacttcatcgccaagagggaaagagacaatgagttgt
gtctcgaacaacagaggaggattcgggcggctaatccctgtagccgcaagtatgttgctagcccggaggacacagacggttatattccctacgttcctac
gaaagctgacgctcttgttgattatgtcgtcattgatgatgaagttgtgtttcttaaagattagtcttgaagacagagtgcaagccatgaaattcaactc
agaggatggctcgtttactatctaactgtgtcccatctcctgctatgttatgtttggcactccagtttatcgtt
page-top