Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig648
Contig Information
Length 1160 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10c20    rwhms10c20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Voltage dependent anion channel (VDAC) [Triticum aestivum]
Score 1373
Evalue 1.11992e-149
Total Hit Count 349
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig648
CGACGCTGCCGCTTCCCCGCGATCTCTCTCCCGCTCTCTTCTCCCCACCACCACCCAAGTCGTCGTCTCCGTCGCCGGCCGCCATGGCTCCGGGCCTCTA
CACCGACATCGGCAAGAAGACCAGAGATCTGCTCTACAGGGACTACTGCACGCACCAGAAGTTCACCCTCACCACATGCACCCCCGAGGGCGTCGCAATC
ACAGCTGCAGGAACTAGGAAAAACGAGTCTATCTTTGGCGAGCTTCAGACCCAGCTTAAGAACAAGAACTTGACAGTTGATATCAAAGCAAACTCAGAGT
CAGATCTTCTGACAACATTCACAGTTGACGAGTTTGCAACTCCAGGGCTGAAATCAATCCTCAGTTTGGTTGTTCCAGACCAGAGGTCAGGGAAGCTTGA
ACTCCAGTATCTCCATGAATTCGCCGGTATCAATGCAAGTGTTGGGCTGAACCCGAACCCTATGGTTAACCTTTCTGGTGTATTCGGAAGCAAAGAACTG
TCAGTTGGTGTTGATGTTTCATTTGACACGGCAACTAGCAATTTCACCAAGTACAACGCTGCTTTAAGCCTCACGTATCCGGATCTTATTGCCTCACTCC
ACCTGAACAATCACGGTGACACCTTGACTGCGTCTTACTACCACTTAGTAAAGTCACATTCTAGCACCGCTGTTGGAGCAGAGCTGTCCCACAACTTCCC
AAGGAACGAGAGCACATTGATATTTGGATCACAGCACTCATTGGACCCGCACACCAGTGTGAAGGCACGCTTCAACAACTATGGCATGGCTAGTGCCCTT
GTCCAGCATGAATGGCGAGCCAAGTCACTCGTTACCATCTCCGGCGAGGTTGACACCAAGGCAATTGAGAAGAGCACAAAAGTTGGTCTGTCATTGGTGC
TAAAGCCTTGAGATGCACAGCTGGGACCCTATGTTTTGAAAAAAAAGGTTCAGTTCTGCTGGATTGGAATAACATGGCCCCAGGTCATCTCTTCGTGCTT
TCATTTTGATCTTGAATTCCTCCTTTGTCCACATAATCTGTTTCCTAGGCAAATGTTAGCCTTGACCTCCTCGTTATTTTGATTTGATCATCAGCGCCTG
TCAATAATTTCTGGTGATTAAGACCTATTGTGAATCTTGTCAAATGTGACAGATTGGCGG
page-top