Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig438
Contig Information
Length 548 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10d11    rwhms10d11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cystatin [Triticum aestivum]
Score 668
Evalue 1.48956e-68
Total Hit Count 221
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig438
CAAAGTCCCACATAACTATCTCAAGATCAAGAACCCCACTAGACAATCCAATAGCCATGAGGACATCTAGCTTCCTCCTCATCATCATTGTTGCGTTCCT
CTATGCTATCGGCTCACCTGCCATAGGCTGTGGGGAACGGATGGGCAACCAATTGTGGAACACAGCAATAGAGAATGGATGGGAACCAATCGGAAACATC
AACGACCAACACATCCAGGAGCTCGGCCGTTGGGCGGTGTTGGAGTTCGGCAAGCACGTGAACTGCGTGCTCAAGTTCAACAAGGTGGTAAGTGGCAGGC
AGCAACTTGTTTCTGGAATGAACTACGAACTCATCATCGAGGCATCAGACATTGGCGGGAAAGAAGACAAGTACAAGGCAGAGGTGTACGAGCAGACGTG
GACTCACAAACGCCAGCTCCTCTCATTCGCCAAGGTGAACTAGGCGAGTGGCAATAACTTTGGTAGTAATAATTGTGATATACCAGATTTGTTAGCTGGG
TTTATTTATCGACGAATAATTTATCGTCTTGCATTGCCAAAAAAAAAA
page-top