Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig265
Contig Information
Length 484 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10d07    rwhms10d07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 98
Evalue 0.0127603
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig265
GTTATTGAGAAAAGTGATGCCTCGGAGCAGAAAGCAGAAGAAAGTGCTGAGGAGCCTTTGCTCCCTGAGGAGAAGGAGGAGAGAACCAAGAGGAGCCAGT
TCGTGCAGGGGCTGGTGCTGTCCCTGATGTTTGATGACATCTTGTGAAGAATGTCTTGTTCCGAAAATTGATTGAGAAGGCAGCTCTTGCTTCACCAGAA
AGTTGTATACCTTAGCGCGAGTTGCTGCCTTTCACCCAGTTGCCATTAAAAACAGATGGCAGCTTTGTTGTGCGATGTTAAGAAGGATGAATGTTGTGAA
TATGGATGTTGGTTAGTATGCGCGTCGGTCGGTGTCGCATGAACAATAAGATAGTATATATAGGTCTGGTAATTTGATGAGATGTTGTCGGGGGGCTCCC
GCGGGCGGCCCTGGTTGTATGTATGATTGGGTGGCCTAGTGACTGCTGAAATAATTCATCCTATTTATTTTCGGAAAAAAAAAA
page-top