Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig171
Contig Information
Length 926 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10c21    rwhms10c21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0705100 [Oryza sativa (japonica cultivar-group)] >gi|41053091|dbj|BAD08034.1| hydrolase, alpha/beta fold family-like [Oryza sativa Japonica Group] >gi|41053146|dbj|BAD08089.1| hydrolase, alpha/beta fold family-like [Oryza sativa Japonica Group] >gi|113537396|dbj|BAF09779.1| Os02g0705100 [Oryza sativa (japonica cultivar-group)] >gi|215693349|dbj|BAG88731.1| unnamed protein product [Oryza sativa Japonica Group]
Score 576
Evalue 4.00097e-106
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig171
GCGCGTCGGCGTTCCACTGGAGGTACAACATCCCGGAGCTGGCCAAGAAGTACAAGGTGTACGCCGTGGACCTGCTGGGCTTCGGCTGGAGCGAGAAGGC
GCTGGTGCAGTACGACGCCACCATCTGGATGGAGCAGGTCTCCGACTTCCTCAGGGAGGTCGTCCAGTCGCCATCCGTCGTCGTCGGCAACAGCTTANGT
GGCTTCACGACGCTGTTCGCCGCGACGGAGGTGCCGGAGCTGGTCCGGGGCGTCGTGCTGCTCAACTCCGCCGGCCAGTTCGGGGACCCCCAACGCGCCG
CCCAAGGCTGAAGAGGCGGCGGTGGCGGAGGAGGAGGCGAGCGCGGTGACGAGGCTCATCGTGAGGCCGCTCAAGGAGGCCTTCCAGCGGGTCGTGCTCG
GGTTCCTCTTCTGGCAGGCCAAGCAGCCGGCCAGGGTCGAGAAAGTCCTCAAAAGCGTGTACAAAGATCCGAGCAACGTGGACGAGTACCTGATCAGCTC
GATCACGGCGCCAACGGCCGACCCGAACGCCGGCGAGGTGTACTACAGGCTCATGTCGCGGTTCGTGGCGAACCAGAGCCAGTACACGCTGGACAAGCTG
CTGGGGAAGCTGACGTGCCCGCTGCTGCTGCTGTGGGGGGACCTGGACCCGTGGGTCGGCCCGTCCAAGGCGGCGCGGATCCACGAGTTCTACGCCAACT
CCACCGTCGTCAACCTGCAGGCCGGGCACTGCCCGCACGACGAGGCGCCGGAGCAGTTCAACGCGGCGCTGCTCCAGTGGCTCGCGTCACTGGAGGAGGA
GGCCGGCGACAAGCCGGCCGAGCCCAGCCTCCAGGTCGTGTGATTCTTGTACCTTGTTAGACTATGTATAGCTTCTGTACCTATGTACGTATATGGTACA
TATTGTAACACAACCATTATATATAA
page-top