Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig96
Contig Information
Length 964 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms11f14    rwhms11f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0615700 [Oryza sativa (japonica cultivar-group)] >gi|12229920|sp|Q9LSU1|PSA5_ORYSJ RecName: Full=Proteasome subunit alpha type-5; AltName: Full=20S proteasome alpha subunit E; AltName: Full=20S proteasome subunit alpha-5 >gi|8671498|dbj|BAA96832.1| alpha 5 subunit of 20S proteasome [Oryza sativa Japonica Group] >gi|77551899|gb|ABA94696.1| Proteasome subunit alpha type 5, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113645500|dbj|BAF28641.1| Os11g0615700 [Oryza sativa (japonica cultivar-group)] >gi|215737179|dbj|BAG96108.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765321|dbj|BAG87018.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218186097|gb|EEC68524.1| hypothetical protein OsI_36813 [Oryza sativa Indica Group]
Score 1168
Evalue 4.9595e-126
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig96
CCAAGCACCCACCCCGTGGTAGTAGAAATAGAATCAAGTGCTTCGAATTCCGATCCGCATCCGCCGACGCGATGTTTCTCACGAGGACGGAGTACGACCG
TGGGGTCAACACCTTCTCCCCGGAGGGGCGGCTGTTCCAGGTCGAGTACGCCATTGAGGCCATCAAGTTGGGCTCCACTGCAATCGGCTTGATGACTAAG
GATGGTGTTGTACTGGCTGTTGAGAAACGTGTCACCTCACCGCTGCTGGAACCAAGCAGTGTGGAGAAAATCATGGAAATTGATGAGCATGTCGGCTGTG
CCATGAGTGGCCTTATTGCTGACGCCAGAACACTGGTTGAGCATGCTCGTGTTGAGACTCAGAATCATAGGTTCTCATATGGGGAGCCAATGACAGTAGA
ATCTACCACACAAGCTATCTGTGACTTGGCTTTGCGCTTTGGTGAAGGTGATGAAGAATCAATGTCACGGCCGTTTGGAGTCTCTCTCCTTATTGCTGGT
CATGATGAACATGGACCCAGCTTGTATTACACAGACCCATCGGGGACCTTTTGGCAGTGCAAGGCCAAGGCCATTGGGTCGGGCTCTGAAGGAGCTGATA
GCTCATTACAAGAGCAGTACAACAAGGAACTGACCATCGCTGAGGCAGAGACCATAGCCCTTTCTATCCTGAAGCAGGTTATGGAAGAAAAGGTGACCCC
GAACAACGTTGACATTGCGAAGGTCTCCCCTAGCTACCACCTCTACACCCCTTCTGAGGTTGAAGCGGTCATCTCGAGGTTGTGAAGGATTGCCACTTTG
TGAGACAGCTCTTGTATTCCCATGAACCCTAAGGCACAATGAACTATGAACTCTGTTGTGGGTTTGGGTTGTCTGCCTACTGTTGAAGGGATATTAGTGC
CTGCTTGGGCGTTGCATCTGATTCTCATCTCCCAGTCCAGTCATTTGTTTGTAGCACTAAGACG
page-top