Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig95
Contig Information
Length 623 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9d12    rwhms9d12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_007711 [Oryza sativa (japonica cultivar-group)]
Score 352
Evalue 8.97939e-32
Total Hit Count 30
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig95
CACGAAGCTTTTTACGCTCCTTGCAAATGCAGCCCTGCGTCGTACTCCTCCTCACCCTAGCCATCCTCCCTAGCCTCGTAGCCAGCAACACCTCATCTCT
CATCAACACAACGTGCTCGAAGGCTCCTAATGTGTCCTACGACCATTGTGCCAACGTGCTCTCGGCCGATCCAGCCGGTGCCTCGGCCACGGACAAGCGC
GGGCTGCTCATCGCCGCCGCTCAACGAACTGTGCACAGTGTGACATCCACGGTGCATATCATGAGCGACCTAATACAAGAGCTCAACACTTGCATCTAAT
ATTACCAACGTATGGGTGAGTTCACGATGGGCGCCATCGATGATCTCCGAGCAGGACGAGATGCTGGACTCATATATCCAAAGTTACGGGAGGCCTCTGA
TGAGCCCCTAAGGTGTGATACAGCGTTCTTTCACGGAGTCAAGAAGAATCTCATGGAGAAAGTGAACTCAGAGAACAAAATTTTGGCCCACTTAGCCAGT
AGCATCACATTTCTGTTGTTCAATCGGCGTTCTTAGTAGACATGGTCGGGTACTTTACTTTGAGCATCGATCGGGAGCACATATGAATAAAGAGAGATCT
CCACCGCTTCCTTAAAAAAAAAA
page-top