Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig94
Contig Information
Length 824 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9d14    whms19c19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_004737 [Oryza sativa (japonica cultivar-group)]
Score 1040
Evalue 2.655e-111
Total Hit Count 494
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig94
TCGCCGTCCGTCACCGTCGTCGTCGCCGCGGCCCAGCCCTCCGGTCGGCGCTGGTTGCTGACGCGTAGGCGAAATCCGTGCGAGTTCTGCAGATCGTCGC
CGGCAGACAATGTGGGGCGAGAGGGCTCATCACAGGCATGGGCACCATCACGACCACGTTCCGTCCGGGGGTTCCAAGGACCGGCAGCCCAAGTTCATAG
CAGACAACTACAGCTCGGTAGATGAGGTCATTGCTGCATTGAGAGAAGCTGGGCTTGAATCATCAAATCTAATTCTTGGCATCGACTTCACCAAAAGCAA
TGAATGGTCAGGTAGGCATTCCTTTGGAAGAAAATCTCTGCATGCCATTAGTGGCACCCCAAATCCATATGAGCAAGCCATCTCTATAATTGGGCGAACA
CTATCACCTTTTGATGATGATAACTTGATACCATGCTTTGGATTTGGTGATGCTTCTACGCATGATCATTCTGTCTTCAGCTTTTACCAAGAAAACCGTC
CTTGCCGTGGTTTTGAGGAGGTTCTTGACAGATACAGACAAATTGTTCCACATTTGAACCTTTCAGGACCAACTTCTTTTGCACCTCTTATCTACGCGGC
GATGTCAGTTGTCGAAAGCAGTAACTGCCAATACCATGTCCTCGTCATCATAGCTGATGGACAGGTGACCACCTCAAATTCAAGTGCAAGATTAAGTCCA
CAAGAACAGGCAACTATACAAGCAATTGTTGATGCTAGCTTCTATCCTCTTTCGATTGTTATGGTGGGAGTGGGCGATGGACCATGGGATGCAATGCAGC
ATTTTGATGACTGTATTCCTGACA
page-top