Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig92
Contig Information
Length 1301 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9d20    rwhms9d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0137500 [Oryza sativa (japonica cultivar-group)] >gi|122064234|sp|Q6YXY2|HACL1_ORYSJ RecName: Full=Probable histone acetyltransferase HAC-like 1 >gi|113535361|dbj|BAF07744.1| Os02g0137500 [Oryza sativa (japonica cultivar-group)]
Score 465
Evalue 2.56641e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig92
GCTCGGGTAGTCCGCCATTGGTCAAGCCCCCTTCCTTTCTCCCCTCTTCCTCCGTCTCCCCCGCCTCGTCTCCGCCCGCCGCTCGCCGCCGCACAACCTC
CTACTATTGGGTCGGCCCTCCTACCCCCACGGCATCCAGCTCGCGCTGCGCCGGGGTTGACCGGGCCGGCGTGAGACTCGCCCGACTGGCACCGAAGATG
AACGCGCGTCAGACTGCGCAGGTGAATCAGGTCGTCGGCGCCGTCGGGATGCCGCCGCCGCAAAGCCAGACGCAGGACGCGTGGGTCGATTCCCAGTTCG
TGATGATGCGCGGCAACGCCCGAGAAAAGATATTCGAGTATATAGGAAGGAAGCCAAGCTCGGCTGATTGGCGGAGGAGGTTACCGCACCTCGCGAGGAG
GCTTGAGGAAATCTTGTTCAGAAAATACCCAAGCAAGAGGGAGTACTACAATATGATGAAGGGACAAATTGAGCCGCACTTGCAGTTTGCTATCAAGGAG
TTGAGTGCTCAGAACCAACAACGACAACGGAACCAACAATTGTCAAGACAGATAGCATCTTCCCCTGGCTATGGGACGATGATTCTGACACCTGGTATCA
CGCAAGGCGCAAGTGAAACTTCTAGAATGTCTTATGTGACAGGCAATATTGGCCCTTCGTCGTCTGGTGCAGACATGGTTCCTCTGAACGCCAACATGGG
GCAAGCTCCTAATCAGCATGTAAACACACTGCTTTCTCTGGGGATGAACTCTACACACCATGATCGCCCAAGAGCATGCAACAACAACCTTGTGATAGAC
ACAGTGGACACACCTGCAACCAACAGACTCTTGGAATCCCATGCACCTCTGAAGGAGGTCCGAAAGGAACCAAAGTTTAGCTGCCCAGTCTGCATGAATG
AGCTGGTTGATGCGTCATCCACCATCTGTGGCCATATCTTCTGCCAGAAGTGCATCCAGGCCTCCATCCAGGCTCAGAGCAAGTGTCCAACCTGCCGTAG
GACGCTAACCATGAACAGTTTCCACCGCGTCTACCTCCCGACGATGGACTGACCTGATCCACCCTGTTTTATCTTCTCTTTTACCCCCGGGTGCTGCAAA
TCAGATGGTAACATTTCAGAAGGAGGTTTGATTAAGGATGGCATTAACAGGGATATGGACGTCATTTGCTTTTCTTTAAAGTCTTCTTAAGGCATTTGTA
TTATTTACCTGTATAAGATATATTTGCTTCCGCTGTGAGTTGTATCTTGGTCGCAAGACCCTTGTGTTGTATCCATATGTTAAATTGACTCTTCAGAGTG
T
page-top