Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig91
Contig Information
Length 322 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9e02    rwhms9e02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0659500 [Oryza sativa (japonica cultivar-group)] >gi|113565708|dbj|BAF16051.1| Os04g0659500 [Oryza sativa (japonica cultivar-group)] >gi|215765257|dbj|BAG86954.1| unnamed protein product [Oryza sativa Japonica Group]
Score 526
Evalue 3.06948e-52
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig91
TGGAGACTCCAGGGCTATCATATGCAGGGCAGGAAATGCTGTACCTGTTTCGAAAGATCACAAGCCTGATCAGACAGATGAGCGGCAACGTATTGAAGAA
GCTGGAGGTTTTGTTATGTGGGCAGGGACATGGCGTGTTGGTGGTGTACTTGCTGTTTCTCGCGCTTTTGGTGACAAGCTCTTAAAGCAGTATGTAGTTG
TGGATCCAGAGATCCGGGAGGAAATCGTTGACGAGTCCCTGGAGTTTCTCATCCTTGCAAGCGATGGGCTGTGGGATGTGGTCTCTAACGAGGAGGCTGT
CGATATGACCCGGTCAATACAT
page-top