Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig90
Contig Information
Length 465 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9e10    rwhms9e10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays] >gi|195648498|gb|ACG43717.1| hypothetical protein [Zea mays]
Score 165
Evalue 2.23042e-10
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig90
GAGCACAACCCTTGGACACCTCTTCTTCTTCTTCCATAGTAACCCAACCCACCCTTTGCGAAGATGTATAACGCTCCGTCGGGGCAGGAGATGTCCTACA
CGGAGCACGTGCAGAAGCGCCACGAGGAGAAGGGCTGCATCTACGCATGCGTGTTCACAGCGCTGTGCTGCTTCTGCTGCTACGAGACATGCGAGTGCTG
CCTCGACTGCCTCTGCTGCTGCTGCAACTAAACCGGACATGGCCGCCATGGACGGAGGCCGCAAGGCGCAGAGGAGATCCACCGGCCTCCGCCGCCTTTC
ATAATAAGCATATGTGTCTAGTGTCTTAGCTCGATGAGAACTGTATCACAACTTTGCTATAATACTATCTGTCCTTGTAATCATCCATCATGGTTTGTGT
TGTTGCTGCTGCTCTACCATTTTAATTTAATTAGCATCAGATTATGGTTCTCACCAAAAAAAAAA
page-top