Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig86
Contig Information
Length 545 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms11e16    rwhms11e16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Triticum turgidum] >gi|133741923|gb|ABO37958.1| unknown protein [Triticum aestivum]
Score 258
Evalue 5.09858e-21
Total Hit Count 70
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig86
CCTGCTCCTGCTCTGCTCTGCTCCATTGCCTTGCTTTCTCTGCCTGCCTCGAGGAGCTAGCTAGAAAGCGAGAAAGAAACCCGCCGGCGCCGGAGAAGAG
GAAGGGGAGGGAGAGGGAGGATGTCGGACTGGGGGTCGGTGGTGATCGCGGTGGTGCTGTTCGTGCTGCTGTCGCCGGGGCTGCTGCTGCAGCTGCCCGG
GAAGCACCACTTCGTGGAGTTCGGCAACATGCACACCAGCGCCATGGCCATCCTCGTCCACGCCATCATCTACTTCGCCCTCATCGCGCTCTTCGTCATC
ATCATCGGCGTGCACATCACCACTGACTAGACACCGGCTGAGCTCCATCACCCCGGCCGGCCAGCTCCAATTAAGCTGCTCTTCCTTTTTCTTTTTTTCA
TCCATCTGACTCCCGCCTCTCTGTTTTGTTTTGTTCTGGTCTTGCTGCTTGCAAGTACTTGTAGTAGTGTATGTGATCATGTTCGTTTGTTGTCCTTGGT
AATTAAACTCGCGCGTATGTAGCTGCCTTATTAATAAAAAAAAAA
page-top