Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig80
Contig Information
Length 583 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9e18    rwhms9e18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cystatin [Triticum aestivum]
Score 634
Evalue 1.50075e-64
Total Hit Count 165
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig80
CCCACATAACTATCTCAAGATCTAGAACCTCATTAGACAATCCAATAGCCATGAGGACATCTAGCTTCCTCCTCATCATCATTGTTGTATTCCTCTATGC
CATCGGCTCACCTGCCACAGGCTGTGGGGAACCGATGGGCAACCAATTATGGAACACGGCAATAGAGAATGGATGGGAACCAATTGGAAACATCAATGAC
CAACACATCCAGGAGCTCGGCCGCTGGGCGGTGTTGGAGTTCGACAAGCACGTGAACTGCGTGCTCAAGTTCAACAAGGTGGTGAGTGGCAGACAACAAC
TTGTTTCTGGAATGAACTACGAACTCATCATCGACACATCAGACATTGGCGGGAAAGACGACAAGTACAAGGCAGAGGTGTACGAGCAGGAGTGGACTCA
CAAACGTCAGCTCCTCTCGTTCGCCAAGGTGAAATAGGCGGGTAGCAATAACTTCTGTAGTAATAATTGTGATGTTGCAGATTTGTTAGCATGGTTTTTT
AATCGACTAATAATTTATCCTCATGCATTGCCATGCTTGTAACATATCAAATAGCATACATCTACAGCTTGACAAAAAAAAAA
page-top