Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig79
Contig Information
Length 1029 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms1d22    rwhms1d22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_31695 [Oryza sativa Indica Group]
Score 719
Evalue 6.4074e-74
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig79
GGTCAGAAATTGTCTGGCGTTGCTGGGAGCCCAGCCTATGTGGCGCCTGAGGTGTTGTCAGGAAGCTATTCTGAGAAAGTAGACATATGGGGTGCTGGGG
TGCTCCTCCATGTACTACTGCTTGGTTCACTTCCATTTCAAGGAGGCTCTCTGGAAGCTGTCTTTGAAGCTATAAAGACAGTTGAGCTTGATTTCAACAG
CGGTCCATGGGAATCAATGTCAGTTATTGGACGGGATCTTATAAGTCGAATGTTGGATCGAGATGTCTCTTCTAGAATAACTGCTGATCAAGTTCTTTGT
CATCCATGGGTGTTGTTCTACACGGAATGTACCCTGAAGGCTGTAACTCCTGATGTCACTAACAAGATTGTAGCACCCAAAATTCCATGGGACAGAATTA
GATCACATTGTGAGTCGTCAGCTTCAGATTCGTCGAGCCAGAGGTCGGAGGACCAGGATGAATGTGGCATAGTCGACGCACTGACAGCGGCAATAACACA
TGTTAGAATATCGGAGCCGAAAAGGACCCGGCTTTGCAGCCCCGGCATTCCCATACAGCAGGAGTGCTCCTCAAACTTGAAGAGCAACCTGTGCACGGCG
TTCTGACATGACCCCAATGTATAGCTCCTTGTGTGTTGGTCTGATGTCAGTGATGGCTCGGCCTGCTGGTTGTCTCTGTGCTGAGGATAATAACTCNGGG
TTTTCCTGTCAGAGCAAGCAAGCATTTGACATGGTGATGCTGTAGATTGCGGTGATGGCTGATGAACCCGACATGGTAGCTGATGCTGTAAATTTTGTAA
ATAGAATGATCCATGTAGCTAATTTATATCTTGAGAGTTGAGAATAATTTCAGTCTATGCTGGTAAACGTAGTGTGCACCATCATCCTTGTTCCATTCTT
TGTTTCTTCCTGTTCCTCCTAGACTATTGAGGATTAGATTTTTGCATCGATTTCCTGCATTTGATATTATTATTTTTTGTTAATAGATCTTTTTCGCTGT
GAATGTATTTCCAGAAGCTGACTCTAATC
page-top