Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig78
Contig Information
Length 780 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms1d08    rwhms1d08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0542600 [Oryza sativa (japonica cultivar-group)] >gi|113579747|dbj|BAF18110.1| Os05g0542600 [Oryza sativa (japonica cultivar-group)] >gi|215715282|dbj|BAG95033.1| unnamed protein product [Oryza sativa Japonica Group]
Score 494
Evalue 4.93195e-48
Total Hit Count 66
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig78
AAGTATTCCCTACAAGGCATCTGCTAAAGCTGGACACTACGTTGAGTTCTTACTGTGATATGCAACGTGTCCTGTTTGAAGAGGAACAATCAGCATATAA
CCAAGCTATGCTTCAGAATATTTGTGATGGGAAGATGCACCCACTTACATCTATGCACCATACCTCCACATACAATGCTTCTCTATGCAAACTGATGGAA
TACTGCTTGACCCCAGCCATAACTGTGCTTGAGGACCGTGTGAAAGAAAACGAACTTCGGTTAGCTATGCTAGTGGAGGAGGCTAAACAACTGGAGGCCG
AGCAGAGCACGAAAACTGGCTCTCCTCGCCGTGCGATGCCCGGAGGGACTACCAGTGGCATCACTTCGCCAAGGGGCCAGGACAAGTACCCTTCCGGCAG
ACAAGGGGGCCCTATAAGCCCTAGCAGCAGCGGCCGGAGGAAGGCTCCTTGAATCCGACCTTGCTCGCCATTCTGTGATGATGGATAGTCCGATTCTCGG
CCCTGCCTGATGCTTTCTGGAACCCCAAACCTGTCCCTTCGCGCGAGGGGTGAAGTCGCAATGCAAATGTACATACCCATCTCCTTTCAGCGCCTGGCCC
GCCGTCCTTCTGTGGAAGTAACCAACCAACAGTGGTTCCCTTTTGCTTTGTGTTGTCCTTGCGCCAAATCCTTTTGCCTGGTTGCGCTGAGCTTGTAATG
TGTACTCACTGGCGCGACGAGTCTCGGGCAGTGGTTGCGCTGAGCTTGTAATGTGTACTCACTGGCGCGACGAGTCTCGG
page-top