Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig76
Contig Information
Length 902 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms1c24    rwhms1c24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27764 [Oryza sativa Indica Group]
Score 594
Evalue 1.62013e-59
Total Hit Count 209
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig76
ACCTGATTCTGCAGCGTCCATAAAGCCAATGCGGTACACCGACGAGCCGCCACCGCCCTTCGCCGGCGTCGGTTATGCTAATGCCGTGGTCGTCTTCTCG
GTGAAGGCGACACAATTAGATGATAGCCTGGATTGGCCGCTCGATGTATACGGCATCGTTGCCGCGCGGGATTCAATTGACCGCAATCGCAACCTCCTCT
TCAACCGCACCAGAGACAATTGCCAGAGGCTCACCGCAGGGGATGCCTCTCTATTGTTGACCGGTCCAAGTCGTGCTGTTGTGATCGTTGATCCTGTCAA
CTATGAGGTAGAACTAAAAGTGAAGGGTGACACGCCGTCTGAAGATAAACTCTTGAGCCTTCTAGTCATCGAGGACAAGTACTATCTTCCTGGTGATCGC
CGCCAAGGAGTTCATTGCCACACCTACTCTTCTAAGCTAAGCACAGTGGAGGTGACGGTTGGCCATCTTGCAAAGACAGTGGAGGCTACTATCGCTGTGC
AAGTTGTTGAGGGATCCTGGCCAACTGGCCATCACGGGCGATTTGCTGCACATATGGCCAGTCTCGATGATCTGGAGATGGTGCTACTTGATTCTCAGGA
TGGCATGGTACCTGTTACGAAAGATGGGGCAATTGAGTTTTCACGATGTGTTGTTTCTGTCGAAGCGGATGGAGAGCTGACACTTGGTGTGGATGTCTGG
CAAGGTGATGACAAGGCTGTCAAATATCAAGTAAGATTTGTACCTGGAAAAGCAGGTAGAAGTGAGGATATTTGTGATGTTGGGTTTTGTAAGATGCGAT
TCACTGTTGCTTGGTCGCTTCTTTTGAACTGGTGACATGTAGTAAATCAGTTTGGCATATGTGGCGTTGTTTATGTGTTATGATCTAATTTGTGACCTAA
AC
page-top