Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig71
Contig Information
Length 690 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms1b23    rwhms1b23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 38.7K protein [Agrotis segetum nucleopolyhedrovirus] >gi|71559183|gb|AAZ38182.1| 38.7K protein [Agrotis segetum nucleopolyhedrovirus]
Score 80
Evalue 3.97495
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig71
CCTCGCCGGCGGAGGCGGAAAGAAGGCAAACAAGGAACCCTAGCCGCCTGAGGAAGGAGCGCCCAGATCTATCCGCAAGACCGGCGAGGATCCATGGCAG
CGGTTCGATGCCTGGCGAGGAGGCTCGGTAAAACGCTGGCGACGGTCGCGGAGGAGCGACGCGGCCAACTCGTGCCAAGAAGGTTCTTCAGCGAGCATGC
TCATGAGATGAAGCAGAAGATGAGGAAGCAGAAGGTGGAGGAGCTGTATGATGCCTTATACAAGCGGGGGGAAGATTCCCACCACTAGTCCCTCTGTACA
AGCCAGTCAAGAACCCGACCGTCTGCGTACTCGGCGTTATGCAATGAGGATTCGGGGTGTGTTTGACTTAGCTGCCAAGATGACGTTAGGCTTTATGCTG
GTTGCTTATGCGGTTAGTCCCAAACTGCCCAGAGAAGAGGACACCACCAATAATTGCCCACAATGCGGCTTGAGAACATCAACGACCAGAGAAGGCACCA
CCAATAATTGAGAACCAAAGATGATGCTATCTTTAATTTGTGATATTGTGTGACATGGTATCATGTAATTATATCTCTTGTCTATTAACTAATTGAGTAG
AATATACAGTACTCGAACAAATTGTGCAAGGAATCAGGTCTCTTCTACATTGTATCATGTAATTATATCTCTTATCTATTAAAAAAAAAA
page-top