Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig70
Contig Information
Length 668 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9o15    rwhms9o15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0212200 [Oryza sativa (japonica cultivar-group)] >gi|113563828|dbj|BAF14171.1| Os04g0212200 [Oryza sativa (japonica cultivar-group)]
Score 334
Evalue 1.28866e-29
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig70
CAAGCAGTCAAGCAGCAAGAGCGGGAAGATCTCCATTCTCTTCCTCCTGGACCTCCTCGTCCTCCATCTCCTCCATTTTGATCATGGCATCCAAGGCCCA
AGGGTCCTCCTCTGTGAAGGCACTGGTTGTTGAGGACAACACAGTTCAAAGGATGGTCCTCTCGCAGAAGTTACACAATTTTCAATGTGAGATTACTCTC
GCCGTGAATGGAAAAGAAGCAGTTGACCTATTCCTTGAGGGCAAGAAGTTTGACATTATTTTTTGCGATAAGGACATGCCCATCATGACTGGTCCTGAGG
CAGTTGTAAAGATCCGTGCTATGGGGGAAACTGATGTGAAGATTGTTGGGATGTCAGCTGATGATGATGCCATGGAGGTGTTCATAAGTGCTGGTGCTGA
TATTTTTGTGCCCAAGCCTTTCAAGGTTCAGGATCTCGAGTCTATAATTAAGGAAGTCATCAACAAGAAGAAGAACACCATGGTCTAGCACATTCGAACT
TCCTTGAGCGATGGACGAAATATTTTTCTGCTTATGGAGCTATGTTTTCTTATGTATGCATTGTTGTGTTGTTTACTTTCATTGTGTTGTTTAATTTCTA
AAGATTAATGTTTAAGTTCGTTCGTTCTAAGCAAGAAGAACATGAGACTCTATCCTTCAAAAAAAAAA
page-top