Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig69
Contig Information
Length 630 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10n16    rwhms10n16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Defender against cell death 2; Short=DAD-2 >gi|5918185|emb|CAB56224.1| defender against death (dad) 2 [Hordeum vulgare]
Score 554
Evalue 3.51883e-55
Total Hit Count 170
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig69
CGTCGTCTTCCCCAGCACAGCACAGCACAGCTCGAAGCGGCGGAAGCAAGGATGCCGAAGGCCGCGGGGGATGCCAAGCTCCTGATCCAGTCCCTCACCA
AGGCCTACGCCACCACGCCCACGAATCTCAAGATCATTGACCTGTACGTGGTTTTCGCGGTCGCCACTGCCCTGGTTCAGGTCGTTTACATGGGAATAGT
TGGGTCATTCCCCTTCAACTCTTTCCTGTCTGGTGTCCTGTCATGCATTGGAACTGCAGTGCTTGGTGTTTGCCTCCGTATTCAAGTCAACAAGGACAAC
AAGGAATTCAAGGATCTTCCCCCGGAGAGGGCCTTTGCTGATTTCGTCCTGTGCAATCTGGTGCTCCACCTGGTGATCATGAACTTCCTTGGATGAGCAA
CTGTCATACAAGCTGTCGAGATTTTGTAGTGTCCTAATGTCTAAGACTGTCAGCATGTTAGATATTCATGTGGCACCATACACACCTATGTAATCCGAGA
GTTTCTCTATGAACTATAAGAATTCAGTGGATTTAGTGTTAACTTTGTGGAACATGAGAACTTATTCGATTGAGTGAAGACAGCGAAAAGTGATCACTTA
AATATTAGTATTGTTCACTCAAAAAAAAAA
page-top