Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig68
Contig Information
Length 691 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10m13    whms16d01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit fibrillar collagen chain FAp1 alpha [Stigmatella aurantiaca DW4/3-1] >gi|115364640|gb|EAU63711.1| fibrillar collagen chain FAp1 alpha [Stigmatella aurantiaca DW4/3-1]
Score 100
Evalue 0.0190634
Total Hit Count 55
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig68
GAGATAGCGGCTGCGTCGGCGCCGAATTCCTTGCCGGCGATGGCCGCGCCGGCAATTCGGGATGCTCGACGGCGATGTTGCGTCCGGCGTCGATCTCCCC
CGCTGTGCTCGTTGAGTATGTGGTGCCGCCGTCCTTGAAGGCAGACGTCCTGGCCATGGTGATGGGGGCTGCGTGGGCCGTTGCCACTGATGGCAGGCAC
GGTGTCCGGGAAACGGCGGCTGCTCGCGCTACGGTGACGGCCGGCCCGGAGACGGCCTCCGCGCGGAAGACGGAGGCTGAGCGGTTTCTGTGTGCTGGAG
TTTGCTCCGGCGGCGTGGAGAGGAGCTGCAGCCGGCGCATCGCAAAGGGATGGAGGCCCCCTTCTCCCATCCCAGTCACCGATTATATGTGGGCGCAGGT
GATCGTCAGAGGGAGGAGGATGAGCGGCAGCATGCGGCGGATCCTGAACCTGGGGTTGTTCGAAGGGGTCAAACGCGCGTATTCGCTGCGGCGCCTGAAC
CTGGAGCTCTCCAAGGTGAAGTTTTTCCACCCGACGGCACAANAGGCGGCCGCTCATGGCAAGGTGCTGCCAACACTGACGCCANCCCAGGCCGANGCCA
CCANCANGACAANGATCTGCAACACCNATCTGGCNACNGCNGANGCNNCNNCNCCCAANATCNATCCNCCAAAAACCNANCTGGTCATAAA
page-top