Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig67
Contig Information
Length 1196 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10m04    rwhms10m04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit peroxisome type ascorbate peroxidase [Hordeum vulgare subsp. vulgare] >gi|148250118|gb|ABQ53157.1| peroxisomal ascorbate peroxidase [Triticum aestivum]
Score 1266
Evalue 2.99907e-137
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig67
CACCTCACCTCGCTCCCCGTCCCGCCGATCTCTTCTCTTAGGGTCGTCCGCGATGGCGGCTCCGGTGGTGGACGCCGAGTACCTGCGCCAGGTCGACAGG
GGGCGCCGCGCTCTCCGCGCCCTCATCGCCTCCAAGGGATGCGCCCCCATCATGCTCCGCCTCGCATGGCATGATGCTGGCACGTATGATGTGAACACAA
GAACTGGTGGTGCAAATGGTTCAATTAGATACGAGGAAGAGTACACCCATGGTTCAAATGCTGGCTTAAAAATTGCTATTGATCTCCTCGAGCCTATTAA
AGCGAAGCATCCAAAGATTACATATGCAGACCTTTATCAGCTTGCTGGAGTAGTTGCAGTTGAAGTCACCGGGGGTCCAACCGTTGAGTTCATCCCTGGA
AGACGTGATTCGTCAGTTTGTCCCCGTGAAGGGCGCCTTCCTGATGCTAAGAAAGGCGCACCACATCTAAGGGACATCTTTTATCGAATGGGCTTAACAG
ACAAAGATATTGTAGCACTATCTGGGGGGCACAGCCTGGGAAAGGCACATCCTGAAAGGTCTGGTTTTGACGGTGCATGGACTCGTGACCCTCTGAAGTT
TGACAACTCATACTTTCTTGAGCTACTGAAGGGGGAATCGGAGGGTCTTCTGAAGCTCCCTACTGATAAGGCATTGTTGGATGATCCTGAATTTAGACGT
TATGTGGAGCTTTATGCAAAGGACGAGGATGCTTTCTTCAAGGACTATACTGAATCACACAAGAAACTTTCTGAACTTGGCTTCACACCACGGATCAGTG
GCCCAGCTTCTACAAAATCAGATGTTTCAACTGCTGTTGTACTTGCACAGAGTGCAGTGGGGGTAGCAGTTGCGGCAGCTGTAGTCATCGCGGGCTACCT
GTACGAGGCTTCCAAGAGGAGCAAGTAAGGGGTTTCATGAGTTCTTGGATGGCATTGCCTTATTTAGTAAGTATATCAAGTTATTCTTAAAAAAATAAGT
GCCAAGTTCAAATAATAGAACTCTAGTGATGAACAACCAACAGCAGTCTTAAAATATTTCAGGCATTCTTGAGGACATCTCCTTCATGTATACATCATAC
TTGAATATTTCAGTGACAATGAATGCTTACTATTAAAAGCATTTTTGGGCATGTATCTTGTGCAATACAAAAGAACTTGTTTGTGTCCTGAAATTA
page-top