Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig66
Contig Information
Length 1038 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10l22    rwhms10l22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_019314 [Oryza sativa (japonica cultivar-group)]
Score 965
Evalue 1.92987e-102
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig66
CCCTTTCTCCCAACAACTGGAGTACTTCAGGGAGTACCAGTCCAAGCTGACGGCGTTTGCTGGGAGCAGCCAGGCCAAGTCCATCATCAGCGGCTCGCTG
TACATCGTCAGCTTCGGTGCAAGTGACTTCGTGCAGAACTACTACATCAACCCTCTGCTCTTCAAGACCCAGACCGTCGACCAGTTCTCGGACCGCCTCG
TCAGCATCTTCGTCAACAGCGCGACGCAACTGTACGGCATGGGAGCGCGGCGCATCGCGGTGACGACGCTGCCGCCCCTGGGCTGCCTCCCCGCGGCGAT
CACGCTGTTCGGGCACGGGAGCACCGGGTGCGTGTCGAGGCTCAACAGCGACTCCCAGCGGTTCAATGGGAAGATGAGCGCCGCCGTCAGCTCGCTGGCG
AAGCGGTACCACGACCTCAAGATCGCCGTCTTCGACATCTACACGCCGCTGTACAGCCTCGTCACCTCCCCTGGAGATCAAGGGTTCACGGAGGCGAAGC
GGGGATGCTGCGGGACGGGGAAGGTGGAGTTCACGGTGTTCCTCTGCAACCCCAAGTCGGTGGGGACGTGCCCGAACGCGACGACCTACGTGTTTTGGGA
CGCCGTCCACCCGTCGGAGGCGGCCAACCAAGTGATCGCCGACGCCCTCCTCGTCACCGGCATCGACCTCGTCACATGATGAGCCACGCACTGGTCAGCT
AACGTCGTCATCGGTCGGAAGATGACGATGGCGCACGTACGCTTTTCAGGCGTCCCGAAGGGAAAATAATGTGTGCCCAGAGCTCCCGTTGCCAAGCGTG
TCGATGTGGCGGGAGGGGTTACTTTCTCGGGCTGTGCCACTCACTATATCGCCAGCGTTGTAGCTAGGGACTGGGACACATGGAGACATGGTTTATACGT
ACCAAAAGCTCGAAGTTATGGGTGCAAGCACTGGATCTTTGTTTTTTTCTTTCATTTATGTCCTTAAAATTTGATGATCACCGTGTTTTTTCGCAAATGA
TTGCATGGCTCCTTTGAACAGAACCTGTGTTTCAAGTC
page-top