Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig63
Contig Information
Length 622 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10l15    rwhms10l15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit leucine-rich transmembrane protein [Aedes aegypti] >gi|108884516|gb|EAT48741.1| leucine-rich transmembrane protein [Aedes aegypti]
Score 83
Evalue 1.38031
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig63
GCACCCATCCTCCAAGAGCAGCCTCCTCTTCCTCTCATCCGTTGCCCCTGGTGCCACAACGGCGACATCGAGTGGTGGGTTTCCCGGACTCCCAAGAACC
CCGGGAAACACTTCTACAAGTGCGAGCGTCACTGGCAGCAGAAGTACGCAACGCTAGCCGCTGGGGCAGTGATTGCTTGTGGCGGCGAGAAGCGAGCAGC
AGCTGCAGTACGCGGAGCTGGGGCAGGGGCAGCCCGTGTCGGCGAGCAGCGGCAGCCCGTGGCGTCAGCGAGCAGCAAGAAATAGGTGGCACAGACGAGA
TGGGGAGCAGTAAATCCATGCTGCCAACTCTCAAGGTCCTCCTCATCCTGGGGATCCTCAATCTAGCGCCGTTCTGTATCTCTTCCTGAGGCTCAACTGA
ACTTGTAAATAAGATCTCTGTAGCTAGCCTAATTCTTTTTTCTTTTTTGCGGAAAATCACCTGGTTAATTGTTACCTGCCCTTCGATCCAGGAAGTTCAT
GTGAAAATAAAAAGTTCCAGGAAGTTCAGATTTATATGTAGCTTCTCTATCTTCCAAGATGTAACCAGGATATTAAGTTCCAGGAAGTTTACTTAATATC
CTGGAAGACAGAGATGCTGGTT
page-top