Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig60
Contig Information
Length 494 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10k19    rwhms10k19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11539 [Oryza sativa Indica Group]
Score 403
Evalue 5.74642e-38
Total Hit Count 229
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig60
CACCAGCTTCTCTTCCTCCTCCCGCAGCGCCTCCTCGAATCCAAGAGATCAAGTCGCTGTTGTTGTGCCACTCCCCCTCCAGCCGCCGTCATGCAGAACG
AGGTGGGTGACATGGTGGACCTCTACGTCCCCAGGAAGTGCTCGGCCACCAACAGGATCATCACGGCCAAGGACCACGCCTCTGTCCAGATCAACATTGG
TCACGTTGATGAGAATGGCCTCTATGATGGCCGCTTCACCACCTTTGCTCTCTCTGGGTTCGTCCGTGCTCAGGGTGATGCTGATGGCTCCCTGGACAGG
CTGTGGCAGAAGAGGAAGGCTGAGATCAAGCAGCTCTAGATGTTGCTAGTAGTTTTACCTGGAACTTGTGTCCTTCCCATGTCTACCTAGCTCTTGGATG
TTCTGTGGTTGGTTTCAGTTGCTGCTATGGAAGCTAAGACTTGATGTCACTTGGCCTGGTTTATTGTGAACATGTTTTGAGTTTAAAAAAAAAA
page-top