Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig59
Contig Information
Length 506 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms10j12    rwhms10j12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0299400 [Oryza sativa (japonica cultivar-group)] >gi|57899040|dbj|BAD87814.1| unknown protein [Oryza sativa Japonica Group] >gi|57899092|dbj|BAD86911.1| unknown protein [Oryza sativa Japonica Group] >gi|113532344|dbj|BAF04727.1| Os01g0299400 [Oryza sativa (japonica cultivar-group)] >gi|215765939|dbj|BAG98167.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218188048|gb|EEC70475.1| hypothetical protein OsI_01528 [Oryza sativa Indica Group]
Score 373
Evalue 1.85152e-34
Total Hit Count 48
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig59
CCCCTATGGCGGCCTTCGCCTGTGCATCTAATGTGCGCCGCCTCCTCCTCCACCCCGGCGGCGGAGCTCCGGCGAGATCCTTCTACGCCCAGCCCTACCA
AGCCAAGGTAGGCGTGGTGGAGTTCTTGAATGGGGTCGGGAAGGGGGTGGAGACGCACGCCGCGAAGCTGGAGGAGGCCGTAGGAGGTGATCTCCAGAGG
CTGCTCGAGACCCGCACGCTACGGCTCAAGAAGCTCGGCGTCCCCTGCAAGCATAGGAAGTTGATTTTGAGTTTTGCTCACAAGTACCGCCTTGGTCTTT
GGAAGCCCCCGGCAGAAGCCAGGAAAGTGCAATAAAGTTGGTTTGTTTTCGAAGTGTCCACTTGGAGAAATTCATGCTTGGGGCATCGAATAGTTGTGTT
GTAATTTGGACGCCGCAGTTAGAAGGTTATCTGATAACTGATGAACTCTTATGCACATCCAACCAATAACTGGCCCACTTGATGGTATTCTTTTGTAAAA
AAAAAA
page-top