Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig58
Contig Information
Length 946 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9o12    rwhms9o12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0103300 [Oryza sativa (japonica cultivar-group)] >gi|113563570|dbj|BAF13913.1| Os04g0103300 [Oryza sativa (japonica cultivar-group)] >gi|215692673|dbj|BAG88093.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215694630|dbj|BAG89821.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215706915|dbj|BAG93375.1| unnamed protein product [Oryza sativa Japonica Group]
Score 586
Evalue 4.98866e-101
Total Hit Count 169
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig58
TATTGGCAGTTCCCTTGGTCTTCTCTTCTGCGGGAAGGACATCGAACCAGTCTGGGGCCGCAAGGAGTTCTTGAAGTTCATTATCTTGATCAACTCCATC
TGCGGCATCCTTGCGTTCTGCATTGCTGTCGCACTGTACTATGTCACCGGGAAAGAGAGCTTCCTTGTAACGCCACTTTCTGGCTTCCATGGCGCCCTTG
CCGGCTTTCTGGTTGGCCTGAAGCAGCTGTTGCCAAACCCTTGAGCTCCCCCATGTGCTTTTTCTGGAAAATAAAGGCTAAGTGGATGCCATTCTTTGTC
ATGTGCTTCTCAACTATCATGGCCTTCATTGTGCCGGATTCCATCAACTTCCTGCCGACTTTGTTGTCTGGGATGTACGTCAGCTGGCTTTACCTGAGAT
ACTTCCAGAAGAACCCACTGACAGGGCTTAAGGGCGACCCAAGTGATGACTTCTCCTTCCCCAGCTTGTTCCCAGATGCCATGCGGCCAGTCACAGACCC
AGTTGCTAACCTGTTCGACCGGATGTTGTGTGCGAGGTCCAAGCCTTCGGAAATTGCCCTCCCAGTTACCGATCCTACCAAGGCATCGAGAAGAAGGGAG
CGTGGCGAGAGGGTTCTCGAGGAAAGGATGGCCGCGGACCATGCGGCTGACGCCGAAGCCCCAGCCCACTCCGCGGAAGATTAAGAAATTTTCCCCTGTG
CTACGTCGCCATAGTGGCCACGGTCGCCTGCCTCCGTGCTTTGTAACTCCTCGGATCTGTGTTCTGGGGAGCATATTCATTTTTACAGTGGACCGATGAT
ATGATATTACTTTACTGCCCCTTTTTCTGTTTCCTTGTTTTGAGAATATTGGTTGGTTAAATTGTGTTGTAGTTCCTGATTACAGTGAGGAAAGAAGAAA
AAGGGTGGCATCCCCTTGCCCCAGATGTTGTAATGAGAAAAAGAAT
page-top