Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig53
Contig Information
Length 507 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9f24    rwhms9f24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Indigoidine synthase A like protein [Rhodospirillum centenum SW] >gi|209957444|gb|ACI98080.1| Indigoidine synthase A like protein [Rhodospirillum centenum SW]
Score 86
Evalue 0.352436
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig53
GTTGCAGTCATCGGTTTATGCTAGTAGCTCTTGTAACTAGCTCTCCGATGTGTTGTAAGTTCAGAGTGCCCCCTTTATCTTTTGGGCTTTCCTTGTTTTC
TTGTTTGCTTGGAGATGTTCTGGCGTAGGTGGTGGTCGTCATTTGGCGTCATGGTGGCATTGATGGCGGAGGAGCCTGCCAAGGTTGGCACCTCAATCTG
CTTGGAGATGGACCAGTGGAAGATGGTGGAGACGACACCTGTGAGTGCGTCAGACCGGTTTATGCCCCAGATCCGGTATGTGGCTAGGCTGGGGATTCCG
GCTTTCGATGTTAGGATTAGGTGAGTGGTCTGGGTAGTGGCCCAGCTAGCACCCCTTCATCATTTGGATAGGAGTAGCGGCATATGTTGCCTAGATGGTG
GATTCAGGCTTATTGTTGTAACACTTTGTAAGGTCCTCGAGAATAATCAATAAAGTGGTCGTATGCATCTCCCAGATGCAGAGGCCGGGAGTCATCCTCC
TTTTCTA
page-top