Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig52
Contig Information
Length 1012 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9g01    rwhms9g01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100194019 [Zea mays] >gi|194694714|gb|ACF81441.1| unknown [Zea mays] >gi|195638322|gb|ACG38629.1| mTERF family protein [Zea mays]
Score 426
Evalue 5.5846e-59
Total Hit Count 147
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig52
CGCGCGCCTCGTCTCGGTTAAAGCCAGCCTCTTCCGGCGTAGATCCATCGTCTCCAACGTCGCTCTCCTGCAAGAGAGTGGGCTAGGTGTTTGTGATATT
GCCAAGCTGTGCCTCACTAGGCCACGGCTGCTCAGCAGCAACCTAGAGCGCGTCCAGGCGGCGTTGGCGTCCGCCGAAGCACTCGGTGTACCCCGTGGAT
CCGGGATGTTCAGGTATGCGATAGAAGCTGTTGCATCCTTCACCGAGGAGAAGATCGCTGCCAGAGGGGGACTACTTGAAGAAGACATTCAGGTGGTCGG
ATGCCGACGTGAGCATTGCTGTGTGTAAGGCTCCGTATTTGATCGTAAAATCAAAGGAATCACTGCAGTGCAGGTCTGAATTCCTCATCTCTGAGGTGGG
GTTGGAACCGGCCTACCTCACTCAACGTCCGGCAATGGTCTGTTACAGCCTAGAGGGCCGGATGAGACCCCGGTACCACGTTGTAAAGTTTCTCAAGGAA
AATGGATTGCTCAAGCGCGACCCGAGCTACTATACTGTTTTCAAGGAGAGCGAGAAGTATTTCATGGATAAGTTCATATGCCCTCACAAGGAGGCTGCAC
CACACCTTGCAGAAGATTATGCTGCCGCTTGTGGAGGGGAAGTGCCCGCTAGATTCAGATTTACATGAACCAACAACGGGCTGTGAGAAGCGACAATGCT
GGAGGAGAAAATGTGCTGAAACTGGATGTATCATGGTCCTTTCTTCTTCGAGGAGACGGAGCATGGCGCAAACTGTGGGTTTGCCTATACGTGATTCTGA
AGGAGGATCAGCTCCGCTTCGATGCATATTGCAGCAGGCATAGGCACCGTGCCTATGGTATATTGAGCTATAGTTCCGCAGACGCAAGGTATGCCTTTTT
ATTGTAGGGCAAGTATAGTGTATTGCCAACTCAATGCATGTTCACATGCTGCCTGGTCTCGCCTCTATTTTTTTTATCAGAGCTCACTGATCTCATCTCA
CTGGCAGTAACT
page-top