Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig49
Contig Information
Length 986 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9g05    rwhms9g05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1081
Evalue 6.33943e-116
Total Hit Count 167
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig49
GGTCGCGGGCTCGCCGCCCCAGGTAGGACGTAGCTAGTCACCCCGCCCGGCCCCGATGGCTGAGGAGCTGGTGCTCGACACGGCGATCCGGGACTGGGTC
CTCATCCCGCTCTCCGTGGTCATGGTGCTCATCGGCGTGCTCCGCTACTTCGTCTCCAAGCTCATGCGCTCCCCGCCGTCGGCCTCCCCCTCCCCCGACC
CCAAGACCGTCAAGGAGGGGCAGGTCGTCATCAGGGCGAGGAACCTGAGGAACGGCGCGCAGTTCATCCCGGCCAAGGCCTTCAAGGCCCGCAAGCTTTA
TTACACCAACGGGGAAGCCGGATTGCTTCATGTTCCTAAAGAGGATGCCCAGAAGGCTCAGGCGGCTATGTTTTCGGACCCAAACATGGCCATGGATATG
ATGAAGAAGAATCTCTCCATGATAGTTCCACAGACACTTACATTTGCATGGGTGAACTTCTTCTTTTCCGGTTTTGTTGCAGCCAAAATCCCCTTTCCAT
TGACTCAACGATTCAGGGGAATGCTGCAAAATGGGATAGACCTGAGTACTGTTGATGTGAGCTATGTTAGCAGCCGTTCATGGTACTTCCTCAATTTATT
TGGCTTGAGGGGTCTTTTCAGTCTCATCCTTGGTGAAGAAAATGCTACTGATGATGCCCAAAAGATGATGGCGATGGGTGGTGGAATGGGCTTTAATCCA
GCAATGAGCTTGAGCGCAGAGAAAGACAGCCTCGACATCATCCAGCATGACTGGGCTTTACCGAAGATGGAGCGTCATGCCGAAGAGGTGTTGAGGAAAC
TACTGAAGAATTGACCTGAACAAGCACGACTAGGCCCTGCAAGTTTTGTTTTTAGCTTGTTGACTCAGTTATACATCTGTAATTGTATTGTTTATTTACG
AGCGCTACTCATTACGAAGCCGTGAGATATCTTTTTCACTCATGTAGTCTGGCAACACTAGTAGAAAAGGATGTATTCCATATCAT
page-top