Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig48
Contig Information
Length 697 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms11a01    whms11a07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_04689 [Oryza sativa Indica Group]
Score 1085
Evalue 1.16202e-116
Total Hit Count 260
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig48
ATGTGCCTTACCATGTCATTTGCTCCAAAAGACGAGCATGAAGCTCAAGTACAGTTTGCGCTCGAGAGGGGAATTCCAGCAATATCAGCTGTAATGGGCA
CCAAGAGACTTCCATATCCTAGCAGGGTTTTTGATGTCATTCACTGTGCTCGCTGCAGGGTCCCTTGGCACATTGAAGGTGGCAAGCTTTTGCTGGAATT
GAACCGACTATTACGTCCTGGTGGTTACTTCGTCTGGTCTGCCACTCCTGTTTACCAAAAGCTCCCTGAAGATGTTGAAATTTGGAATGCCATGTCTTCT
CTGACAAAGTCCATGTGCTGGAAAATGGTTAAGAAAACAAAGGATACATTAAATCAAGTTGGTATGGCCATATATCAGAAGCCAATGGACAACAATTGCT
ACGAGAAAAGATCTGAAGACAGCCCACCGCTATGCAAGGAAACGGACGATGCAGATGCTGCATGGAATGTACCTTTACAAGCGTGCATACCCAAATTGCC
GATTGGTCCATCAGTAAGAGGATCAAAATGGCCAGAGATGTGGCCTCAAAGGCTTGAGAAGACTCCCTTCTGGATTGATGGTTCTCGTGTTGGAGTTTAT
GGAAAACCAGCGAATGAAGACTTCGAGGCAGACTATGCGCACTGGAAACGTGTTGTAAGTAAGTCGTATGTGAATGGCATGGGGATTGACTGGTCTA
page-top