Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig46
Contig Information
Length 829 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9g06    rwhms9g06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0586900 [Oryza sativa (japonica cultivar-group)] >gi|108864549|gb|ABA94459.2| ADP-ribosylation factor-like protein 5, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113645392|dbj|BAF28533.1| Os11g0586900 [Oryza sativa (japonica cultivar-group)] >gi|215701170|dbj|BAG92594.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215764938|dbj|BAG86635.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218186056|gb|EEC68483.1| hypothetical protein OsI_36735 [Oryza sativa Indica Group]
Score 916
Evalue 6.43878e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig46
CCCGGCTGTGGCACGCACGGAACGGCGGGTGACGCGACGACACCTTTTCCTTCTTCCTCCTCGCTTTCCTCCACGAATCCGATCCAATCTCCTCTCCGTC
CCCTCGTAGATCCGATCACCATCGAGGTTCAGATTTGAGGGAGGGGAAGGATGGGGGCGTGGATGTCCCGGGTGTGGTTTCTCATGTTCCCGGCCAAGGA
GTACAAGATCGTGGTCGTGGGGCTCGACAACGCCGGAAAGACCACCACGCTCTACAAGCTCCACCTAGGCGAGGCGGTCACCGCCGCGCCCACCATCGGC
AGCAACGTCGAGGAGGTCGTGTTCAAGAATATACGCTTCGAGGTGTGGGATCTTGGAGGACAAGAGAGCCTACGCGCTTCATGGGCGACATACTATAGAG
GAACTCATGCTGTCATCGTGGTAATCGACAGCACCGACCGTGCTCGGATCAACATCATCAAGGATGAGCTCTTCCGGTTGATTCAGCATGCAGATCTTGA
CAACACGGTGGTCCTTGTGTTTGCGAACAAGCAGGATCTCAAGGATGCCATGTCGGCGGCTGAGATCACAGACGCCCTGTCCCTCCACAGCATAAAGAAC
CACGACTGGCACATACAGGCCTCGTGTGCGATCACTGGTGAGGGCCTCTATGATGGGATGGGATGGATAGCGCAGAAAGTTGCCGGAAAGGCCACGGCAA
GCTGACCACAAAAACATTGTGTGTTTTGGTGAATTTGTTGGAAATGGGTGGGAGGATGGGTTTGTTGTTCCTGCCATTTGGGTGTTTATTTATGTTGTTA
CATACTCCCTCTGTTCCTTCATGTAAGGT
page-top