Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig42
Contig Information
Length 853 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9p02    rwhms9p02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_06132 [Oryza sativa Indica Group]
Score 826
Evalue 1.85584e-86
Total Hit Count 268
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig42
ATGGATCCCCAGTTGCTTGAAAGAGCTCTTGAAGCATCTGGAGATGATTTGGATTTTGCAATAAGGAGTTTGAATGACCTGCGCCTGGAGTCAGCTGAGG
CTATCTTTTCAGCTGCTGTTGGTGAACCTGAGAATGGCCTGTCAACAGCCCTTAAGTTAACGGCTGAAGGTAATGGCCAATTGGATGCTATTAGTGGAAA
TCCACCTGCGACAGATAATTGTCAGACAAATCACCATAGCTCTGAATGGGTTGAGCTATTTGTTAGAGAGATGATGAGCGCCTCTGACATAAATGATGCA
CGGGCTCGTGCATCAAGAGCTTTGGAGGTTATTGAAAAGTCCATCATGGAGCGGACAGGAGCCGAGGCAGTGCAAAACTTGCACAAGGAAAATACGATGC
TAAAGGAGCAATTAGCAATAGCTCTTCGAGAGAATGCTGTTCTGAAGCGGGGGGTTGCAATCCAACATGAGCGCCAAAAAGAGTTTGATGATAAGACACA
GGAGGTTCACAACCTAAAGCAATTGATTTTGCAGTATCAGGAACAACTAAAGACTCTCGAGATCAATAATTATGCACTTAGGATGCATCTACAGCAGGCT
CAGCAGAACAGTTCAATGCCCGGGCGTTTCCACCCTGATGTTTGCTGATAAGCTTTCCATCCTGATGTCAGAACAGTATTTTTGTGTGACCTGAAGTGTG
AGGATAGTGTATTGCTATCAGACCTAAACTACAAGGATCGATGAAAAATAGCGTGTTGATGTTTATTTCCGTGTGACATTGAATCTTTACGTTTGTTCAT
TTTCTGAAAGATGATTGTATCAGAATCTCTTGTTTACTGCTCCAGTGTCTGCT
page-top