Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig40
Contig Information
Length 114 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9h14    whms17o23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_028800 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 113
Evalue 0.000692743
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig40
AGTTTGTTGCTGAACCGGGAAGTTTGTCTAGATGAGGTGAGACCTTCCTTCATATTGTTGTATGGTCTTTGAGGCAATCGGCATGGAGTATTGTTTTTCA
GGTCAAAAAAAAAA
page-top