Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig39
Contig Information
Length 752 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9i03    rwhms9i03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_028800 [Oryza sativa (japonica cultivar-group)]
Score 113
Evalue 0.000692743
Total Hit Count 180
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig39
GGGTGAGAAACAATGCCCGTGCCAATGATAGATCCCGGCGCAATGACAGGCCTCGCAACTTTGACAGGTCGAGGAACTTTGAAAGGAGAAGGGAGAACAC
ACAGGCCTACCAGAGTGGTCCTCCAAACCAAATGCCACCCCATGATGCTGCTCCTCCAAGTCGCGGTGCACAGGGCCCGCCGCCGCTTTCAGGTGCTCCA
CCAAATTACCAGCCCCATGCACCAAACCCACAGGCAGGCTATGCTGCAGGAGGTGGACCAAACTATCCAAATGCACCACCACCCCCTGGATACCGAGGTG
CCTCAGCCCCTGGCTACCCAGCTGGCAACCAAGGTTACCAGGGTAATCCTGGTGGCAACATGCACAATGGACCAGGCCCAGCCTACCATAGCAACAACCC
TGGATACCAGGGTGGAGCGCCAGGAGGCAACCCGCCGCCGCCTTTCGCAGGTGGCAACCAGCCTCCTCCCTACCAAGGCGGTGGTCCTAGCTATGGTGGT
GGTGCACCAGACTACCAGGGCCAACCAGGTGGTAACCCAGGCTACCAAGGTGGTGGTAACTACAACAACGCGGCCCCTCCATATGAGGGAAGGGACGGGC
CAGGGAGGAACTACCAGTAGAGAACACTGGTAGAAGAGCGCCGTGTAGGAAGTTAGTACGAGCTCTGCTCGAGTTGCCCTATGTTGTTCTCGTGGACTTT
TATGCATATATTCTCCATCCATAATGGTGTTTTGAGAACTANAACTACTGCA
page-top