Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig38
Contig Information
Length 793 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9m17    rwhms9m17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Hypothetical protein similar to putative retroelements [Oryza sativa] >gi|27497213|gb|AAO17357.1| Putative retroelement [Oryza sativa (japonica cultivar-group)] >gi|108706160|gb|ABF93955.1| retrotransposon protein, putative, unclassified [Oryza sativa (japonica cultivar-group)] >gi|125584905|gb|EAZ25569.1| hypothetical protein OsJ_009052 [Oryza sativa (japonica cultivar-group)]
Score 79
Evalue 0.0549178
Total Hit Count 31
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig38
ATCTCGTCATTGCGGCGGAGGCAGCGGCAGCGACGGCACCGGACGGACGACCCGGCGGCGAGGACTACCTCTCTCGCGTGTGGAGTAGTTCCCTTTCCTC
TCTCATGCGGTAGCAACTCGGAGGCGCCGTGGGCGGTGCAAGATCCGGGCGAGCTCGGCAGGACAACGGCGTTCTCCGGCGTCCCTCTCCAGCGTCGACG
GTATTATCGCCAGTTTGAAGCTTTGGGCGCCTGCGGCCGGCTCGACAGGTGGCATCAGCAAGCGCCGGCCGGCCTCGGCACTACTGCGGGTGGTTATATG
GTGCGCGGAGCACACCAGTGGGCTTCAACGTCAGGCACATGGATGGCTTCGGTGGGTGCCATGGCCTTTCCATTCTGAATTGAAGTTGGTCCAAAAATGT
CAAACTCTGCCATGGAACAAAAAAGATATAACTTACCTTCATATGGTTGATTCTTCTTAGTCTTCCTTTTGTGAAGCTGTGTAGCAATCTTCCTTTTCCT
ATCTGTAATTAGATTTTCTTAGGAATACTCTCCATTTTCTTAGGAACACGACGTTGTTTCGATGCCTCCAAATGCAGCAGCAACAGAGCCGGAAGAATAT
CGATGGCAAGGTGAGCGACATCTGGCAGATTGTGAACAGAGGCCACGGAAGGTGGCTGGAACCCCAACGTGGCCCCAAAATCAACCACCAACGGGCAGGC
AGAGAGGAGGTGACTCGCCGACTGCAGCGGGGCATGGCGGAGTGGGCAACTATTCCACGCTCTAAAATTCAGGTTTATAGCAATGAAAAAGGT
page-top