Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig37
Contig Information
Length 777 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9o14    rwhms9o14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195638978|gb|ACG38957.1| hypothetical protein [Zea mays]
Score 263
Evalue 2.98928e-21
Total Hit Count 33
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig37
GAAGTTCCACAAGGGCGCCGACAAGCAGTACTGGAAGGCGATATCCGAGCTCATCCCACAGGAGATTGCACACATCGAGAAGAGGACAGGCAAGAAGGAC
AAGGACAAGAAGCCTGGGATCATCGTGGTCCAGGGCCCCAAGCCCGGGAAGGCCACCGACATGGCACGGATGCGCCAGATCCTGTCGAAGCTGAAGCACA
CACCGCCGCCACACATGAAGCCACCTCCACCACCCGCTGTTGCACCTGCCGGGAAGGACGGAGCTCCGGCCGCCGCTGGAAAGGACGGAGCTAAGGCGGC
AGCGACACCTGCTGCCAAGGATGCCCCTGCCAACGGCACTGTCCCTGAGAAGGAGAACGCAGCACCCGCCGTCGCTGCCGCCCCAGCAGCAGCAGCTCCG
GCGCCACCAGCTGAGCCCATCGCCGCTGCCTGAACGAGGATGGCTTCGGTCAGCCGCTAATCCTTCGCAGTAGGGTTATATATTTGGGTGTCAGTAGAGT
TGTTCCAGGAGAGACGGGGAAGGAGCGTGAAGGCCACATACGATGCGAGGTGGTGAAATCGTCTGAGTTCACCACGGGGAATCATGGCGGAGACACACGC
AGTGTACTATTATTAATTTGAGTTTGTTATTATGAGCAGGAGGGTTGTTACTTATGGGACCAGCAAACTTTATTCGTTAATATTGTCATTGCATTTTGTA
GAGAGAAAGAGGGGACTGGTAAGAATAAGGTAAGGCTGTGCTGTATGTGTTTGTATATTATCATCAATGTGATTTGA
page-top