Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig36
Contig Information
Length 758 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9k01    rwhms9k01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 5a2 protein [Zea mays]
Score 118
Evalue 0.000185391
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig36
CAACATAGATCATGAACAACGCAAAAGTAGCTGGAGTGTTATGCTTCCTAGTCCTTGTGGCTCTCTCTTCTTGTTCGCTCCATGCACGAGCAGCCAACGA
CATAGATCACTGCCTCCTTGATAAAAAAAAGGTGATGCGAGACTGTTGGCATCACATCGAAAAGAAACTTGGTGACCAGTACCCGCCACTCCATAGCGCA
TGTTGCAATACAATAAGAGATGCAAAAGACATCCACTGCGTCTGTGATCGGTTCACCGCTCACGAACTGACTTTGCTCAGTCTAGCCAAGTTTGCCATGG
CTACACATGTATGCGGCAATGGGTTGCACACAGGCACTCACTGTGCAGGTTATCATGTTCCAGAAATAAAGCTACCACCTCCACCCGCGGCAAGTACCTA
AGCCTTAAGTATATCCATGGCTAGGAACAGGCATGGCGAATGCTGAGAAGGTCACAGAGATTACATTGGGACTGCTTTATCATGTGGCCTAGTTCCTCCA
AGCCAAGGCCATGAGATGGCAATGGAATAATTGATGGACTGCAAATTGGCTGGAGATATACGAATCAGGTCGTATCTTGGTTATCATGTTCCAGAAATAA
AGCTACCACCTCCACCCGCGGCAAGTACCTAGGCCTTAAGTGTAAGACCATTTTCATAATGGAGAAATAATTAAATAAAGCAAAGAATGATGTCAGATGA
ATGGCATTTGCTGTGTATTTGACCTTTTTTGTGTGTATTAAAAAAAATTGGGCATAGC
page-top