Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig34
Contig Information
Length 1150 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9o02    rwhms9o02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 753
Evalue 1.92814e-149
Total Hit Count 55
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig34
CAGCCGCGCTCCTACGAGGTGCTCGTCTCCGACGCCGCCCGCTCCCTCGCCGCCGCCATCGACGACGGCAGGACCCGCCTCGAGATCGAGTTCCCGCCTC
TGCCCAGCAGCATCTCTTCTTACAAGGGGTCTTCGGACGAGTTCATCGATGCCAACGTCCAGCTCGCTCTCGCCGTTGTAAGGGACCTCAAAAAGCTCAA
GGGGACTCGGTCCTGCATAGTGTTTCCTGATCAACCGGAGAAGCGAAGGGCCTCGCAGATATTCAAAACAGCTATAGATCAGATCGAGGGTATATCCATC
AGTTCGTTGGACGATCTGCCCACCGGGCCTGTCGATACCTTCTTCAAATCGATAAGAAGTACCCTTGATTTCGATTTTGCTGATGACAACGAAGATCAAT
GGAAGTCTGACGAACCACCATCACTATATATCTTTATCAACAGCAGCACGGGGTGACCTTTCATCTATAGAGAAGTATGTGGACCAATTTGCTGCCTCTG
TACCTGCTGTTCTCTTTAACCTTGAACTAGATACCTTGCGTTCTGACCTGGGGCTTCTGGGATTCCCCCCAAAGGATTTGCATTACCGGTTTCTTTCTCA
GTTTACCCCAGTATTTTATATCAGACAGCGTGACTACTCGAAGACAATTGCGGTCACTCCATACATAGTGAACTACAGTGGCGCTGTCTTCCGTCAGTAC
CCAGGGCCCTGGCAAGTCATGCTTAAGCAGGGTGATGGTTCCTATGCATGTGTTGCAGAGAGTGCATCTCGGTTCACTTTGGGGCAGGCCAAGGATGAAC
TATTGAGAGTTCTCGGTTTGCAAGAAGAGGTAGGCAGCCAGCTTGAATTCCTCAGAAGAGGATACAAGAATGCTACTTGGTGGGAAGAGAATTTTGATCA
GGAGAAATCACCCGCGTGGCGAACTTGAGACGCAGCTGCTGGTTCGACGCCGAAACGCCAGTCTGACTGGCAAATGGAGATACATAGGCCAAAGAATGTT
CATATAGTCCCTTGAAAACAGAGTGTTCATGAATCCTGAGCTGATGATGCAACTGAAATTACAGAAAGAAGCGCACACACCAATGTCATAGTCATGCAGT
GTGTACATTGCCTGTGCTGCAACTGTGCCATCTGATATGAGTTCTGAGGG
page-top