Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig33
Contig Information
Length 546 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9o01    rwhms9o01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSIGBa0096P03.8 [Oryza sativa (indica cultivar-group)] >gi|116309353|emb|CAH66435.1| OSIGBa0132D06.1 [Oryza sativa (indica cultivar-group)]
Score 112
Evalue 0.000433627
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig33
GAAGAAAGAGGAGAAAGACAAGGAGGATGGCGGCGCCGGCGGCGAGGAGAAGGAGAAGGAGAAAGACCCCGGCGCCATCGCCGCAGCCAACCTCTACATG
CACTACCCGCAGTTCGCGTTCCCGGGAGGGTACTACCCGCCGAGGCCGGGGTACGCCGCCTACCCTCCGCCGCCGGCCTACCCGCCGTACCCGCCGCAGA
TCTTCAGCGACGAGAACCCGAACGCCTGCTCCGTCATGTAAAAAAGGTTAGAACCTTGGTGGTCTAGAGTGGAAAACAAATAAGAAGGGGAGAAGGGACT
GCATGAGTTGAGGGGTGCCATGGCAGCAAAAATGCCCTCGAGCAAAGCAAATGGCAGCAGCTTGAAGAAAGTACCAGGCTTTTTTGCGGTCAGGTTTTCC
TTTTTTTTGAACCTTTTATGTTTTTACCGTCTGGTATAAAGTAAGTCTGGACTTCCTTGTCAGTTGATGGATGTTTTCATCTTATGTAGATTTTTCTTTT
TGCCTTGTACCGAACTTATGTAAAAACTGTTATTATAAAAAAAAAA
page-top