Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig32
Contig Information
Length 355 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9n22    rwhms9n22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08039 [Oryza sativa Indica Group]
Score 86
Evalue 0.321054
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig32
AAAGTATCGTGACAGAGGTAGATGTCTTCTTGCGTCCTACCCTAAATGACATGGGCTCTCCTATCAGCAAAATAGCTACTCTGGAGGCGCAGATGACGAT
CACAAGAGACCGTATCTTGAGGATAAGTGAATGACTATGAGGTCTACATGTTAAGTATAGAAACCTGACATGGACAAGTGTGCGCTTTGCTGCCACTTCT
TTGCCAGCCGGAGTGGCCTATTTTCAGTGACGATCATGGATCATGGTGTACATGCGTGTATATGTTGTGTCCTGATAGACTGTACTACAAGATTTTCTTG
GAATGGTTTGGTACTTCTGTTTTATTATGCTATGAAGAGTGTATCAAAAAAAAAA
page-top