Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig31
Contig Information
Length 496 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9h16    rwhms9h16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [Saccharomyces cerevisiae RM11-1a]
Score 82
Evalue 0.982196
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig31
CTCTCGGCGGCGGCATGGGAGGCGGGGGCTCTCTCGGCGGCATGGGTGGAGGAGGCCCTCACGGGGGCCTCGACCACCTGATGGGGCTATGAGCGAGCGA
GCGAGCGAAAGAAGCCGTGTCTGCAGGCTATGCGAGAGCCTGAACCAACCCCCAGCGCATGCATGTGTCTGTCGGTCTGTCTGTTGTAGATGTAGTAGGG
GGGAAGAAACTCCGTGCTGTTTGTAGTTGTTTGTGTTGTCAAAAACAGGAAGAAGAGAGTCGTCTGTCTGTCTGTCTGTCTGTCTGTGTGCCCTTTGTGG
GAAGAAGAAGATAGTAGTGTGTTATAGTAGTGTGTCTAGATGTTTGGGTTGTGCTTTGTGTTTGCTGGACTGCATGTAAAAAGACAAATAAACCGGCGCA
GAAGCTCTCCCTGCTCTGCTCTTTGGCAAATGTTGAAGGGTGAAGAGGGATAGCAAGTTGAAACTGAAAATCAGAGTTTTACTTTGAAAAAAAAAA
page-top